Pages:     | 1 ||


-- [ Страница 2 ] --

№ 6. 2011 Следует отметить, что в группе цыплят, обработанных пробиотиком «Торулакт», среднесуточные привесы были несколько выше, чем у их сверстников, получивших препарат «Ацидофилин В-143». Такое явление можно объяснить содержанием в препарате «Торулакт» дрожжей, синтезирующих ферменты, которые улучшают переваривание питательных веществ и их усвоение. Лучшие показатели сохранности цыплят обусловлены успешным заселением кишечника лактобактериями. Так, в соскобах, взятых со слизистой тонкого кишечника у 10 голов цыплят, через 7 дней были обнаружены молочнокислые бактерии, входящие в состав пробиотиков, штаммы Lactococcus lactis B-263 и Lactobacillus acidophilus В-143, что свидетельствует об их высокой адгезивной активности.

Для изучения гематологических и биохимических изменений крови цыплят при применении пробиотиков аэрогенным путем выборочно отобрали по 10 цыплят из каждой группы. Изучали содержание эритроцитов, лейкоцитов, гемоглобина, общего белка и белковых фракций. Гематологические и биохимические показатели крови у цыплят, получавших пробиотики «Торулакт» и «Ацидофилин В–143», представлены в таблице 2.

Содержание эритроцитов в группе цыплят, получавших пробиотик «Торулакт», было выше, чем в группе, получавших препарат «Ацидофилин В-143» на 1,5%.

Содержание общего белка 35,2 г/л у цыплят в 1 опытной группе увеличилось на 9% по сравнению с контрольной - 32,1 г/л.

Также наблюдалось повышение альбуминов в сыворотке крови в группе цыплят, получавших пробиотик «Торулакт» на 8%.

–  –  –

На основании результатов наших исследований можно предположить, что увеличение содержания общего белка, альбуминов и глобулиновых фракций в пределах физиологической нормы свидетельствует о повышении неспецифической резистентности организма птицы.

Аэрогенный способ применения пробиотиков позволяет проводить групповую обработку большого количества только что выведенных цыплят, что значительно экономит затраты рабочей силы, дает достаточно хороший эффект по основным критериям – сохранности поголовья и привесам.

Как можно раннее применение пробиотиков, даже до начала кормления цыплят, дает возможность заселения в кишечник вначале полезной микрофлоры, которая создаст достойное противодействие гнилостной, сапрофитной микрофлоре, опасным бактериям, вирусам, цистам простейших.

Известия Национальной Академии наук Республики Казахстан Таким образом, аэрогенное применение пробиотиков на суточных цыплятах, обеспечивает колонизацию кишечника цыплят молочнокислыми бактериями, обладающими высокой антагонистической и адгезивной активностью, что в конечном итоге положительно повлияло на общее физиологическое состояние, на их сохранность и рост. Изученные нами показатели роста и сохранности являются главными критериями при выращивании молодняка птиц.


1. Сванбаев С.К., Крылов В.Ф. Лечение и профилактика кокцидиозов домашних птиц//Алма-Ата, «Кайнар», 1983.

111 с.

2. Хованских А.Е., Илюшечкин Ю.П., Кириллов А.И. Кокцидиоз сельскохозяйственной птицы//Ленинград, ВО «Агропромиздат», 1990. 149 с.

3. Синявский Ю.А. Медико-биологические принципы конструирования специализированных продуктов питания: Автореф.докт.дисс.–Алматы:-1998.–47 с.

4. Тарасенко Т.Т., Багрянцева О.В., Мусурова Ж.К., Каламкарова Л.И. Использование отечественных штаммов лактобацилл при лечении детей, страдающих упорной диареей //Биотехнология. Теория и практика.-Степногорск: – 1998.

-№4 (8). – С. 65-69.

5. Толеген Ж., Ратникова И.А., Гаврилова Н.Н. Изучение антагонистических свойств молочнокислых бактерий в отношении некоторых возбудителей порчи продуктов питания //Пищ. технология и сервис. -№1 –Алматы:

- Алмат. техн.

ун-т.-2000. – С. 81-83.

6. Дудикова Г.Н., Тулемисова К.А. Препарат пробиотического действия для животноводства //ж. Хранение и переработка сельхозсырья. 2000, № 10. – С. 25-26.

7. Тулемисова Ж.К., Касенова Г.Т., Шабдарбаева Г.С. Препарат Лактотор, как кормовая добавка в птицеводстве //ж. Исследования, результаты. 2002, № 3.

8. Шабдарбаева Г.С., Тулемисова Ж.К. Опыт применения микробиотиков при эймериозе цыплят //Материалы межд. н-п. конф. – М.:

-2002. – С. 34-36.

9. Тараканов Б.В. Новый пробиотик /Б.В. Тараканов и др.// Птицеводство. - 1999. - № 6. – С. 32-33.

10. Тараканов Б.В. Механизмы действия пробиотиков на микрофлору пищеварительного тракта и организм животных//ж.Ветеринария–2000-№1.С.47-54.

11. Егоров И. Пробиотик бифидум-СХЖ /И.Егоров, Ф.Мягких // Птицеводство. – 2003. - №3. – С. 9.

12. Кощаев А. Кормовые добавки на основе живых культур микроорганизмов/А. Кощаев, А. Петенко, А. Калашников//Птицеводство. – 2006. - № 11. – С. 43-45.

13. Данилевская Н.В. Критерии выбора пробиотических препаратов при их использовании мелким домашним животным // Рос. вет. журн. – 2005. - № 3. – С. 39-42

14. Косарев Э. Современные кормовые добавки в животноводстве: альтернатива антибиотикам //Молоко и корма, менеджмент. – 2005. - №1.–С.10-13.

15. Смит Э.Л. Антибиотики в птицеводстве вызывают устойчивость бактерий к антибиотикам у человека/ Э.Л.

Смит, М.А. Борхардт, Б.А. Кьеке и др. //Eurofarmer. – 2006. - № 5. – С. 19-20.

16. Соколова К.Я. Научное обоснование необходимости использования пробиотиков в птицеводческих хозяйствах/К.Я.Соколова, И.В.Соловьева, Г.И.Григорьева //БИО. – 2005. - № 10. – С. 6-7.

17. Зинченко Е.В. Практические аспекты применения пробиотиков/ Е.В.Зинченко, А.Н.Панин, В.А.Панин //Ветеринарный консультант. – 2003. – № 3. – С. 12-14.

18. Егоров И. Эффективность пробиотика терацид С./ И.Егоров, Ш.Имангулов, К.Харламов и др.// Птицеводство.

– 2007. - № 6. – С. 56.

19. Белявская В.А. Экспериментальная оценка биобезопасности генно-инженерных бактерий на модели штамма Bacillus subtilis, продуцирующего интерферон /В.А.Белявская, Т.А.Кашперова, В.М.Бондаренко и др.// Микробиология.

– 2001. - № 2. – С. 16-20.

20. Иванова А.Б. Использование Ветома 3 для повышения продуктивности птицы/Пробиотики, пребиотики, синбиотики и функциональные продукты питания. Фундаментальные и клинические аспекты: науч.-практ. журн. 2007. – № 1-2. - С. 43.

№ 6. 2011 ОЖ: 579. (66+001.57 + 047.64.042) + 579,6 Ж.К.ТЛЕМІСОВА, Г.С. ШАБДАРБАЕВА, С.Т. ЕРНАЗАРОВА, Г.Е. ТРАНБАЕВА



–  –  –

Авторлар жетілдірілген жне Р кзет жаттарымен оралан пробиотикалы серлі препараттар жнінде мліметтер келтірілген.

Пробиотиктерді олдануды жаа дстрлі емес - аэрогенді дісі сынылды. «Торулакт» жне «Ацидофилин Впробиотиктерін салыстырмалы трде аэрогенді діспен олдануды тиімділігін зерттеуді нтижелері жне с басын сатаудаы, салма осудаы жне с организміні гематологиялы, биохимиялы жне иммунологиялы крсеткіштеріне сері жнінде мліметтер келтірілген.

«Торулакт» пробиотигін аэрозольді тсілмен олданан жадайда, жас балапандар басыны саталуы 99,2 %-а жетті, яни бл крсеткіш баылау тобына араанда 8,6 % арты.

Балапандарды тірілей салмаыны орташа крсеткіші 0,8 грама артты, баылау тобымен салыстыранда, бл крсеткіш 18 % арты.

Аэрогенді тсілмен «Ацидофилин В -143» пробиотигін алан топа араанда «Торулакт» пробиотигін алан балапандар тобында эритроциттер саны 1,5 % арты болды.

Тжірибелік топтаы балапандарды анындаы жалпы белокты рамы баылау тобымен салыстыранда (32,1 г/л) 9 %-а сті. Сонымен атар, «Торулакт» пробиотигін алан балапандар тобында ан сарысуындаы альбуминдер 8 % жоарылааны байалды. Бл нтиже организмні компенсаторлы ммкіндігіні артанын байатады.

UDK: 579. (66+001.57 + 047.64.042) + 579,6

–  –  –

Information are brought In article about preparation probiotiks actions designed author and protected safe document RK.

It Is Offered new unconvehion way of the using Probiotiks - aerogenic. In comparative aspect are brought results of the study to efficiency aerogenic way of the using Probiotiks "Torulakt" and "Acidofilin V-143", is shown influence of the introduction Probiotiks on safety of the live-stock of the bird, on VWVhang up, on hematologic, biochemical and immunological to factors of the organism of the birds.

It Is Installed, when using aerosol by way best results has shown Probiotik "Torulakt", which has provided high safety of the live-stock of the saplings - 99,2% that on 8,6% more checking group.

The Factor of the average alive weight beside checking increased on 0,8 gr., in percent to gains of the checking group has formed on 18% more in comparison with checking.

The Contents erithrocytes in group checking, got aerogenic Probiotik "Torulakt" was above, than in group got preparation "Acidofilin V-143" on 1,5%. The Contents general squirrel 35,2 g/l beside checking in 1 experienced group increased on 9% in contrast with checking - 32,1 г/л. Also existed increasing an albumin in whey shelters in group checking, got Probiotik "Torulakt" on 8% that points to activation compensatory possibilities of the organism.

Известия Национальной Академии наук Республики Казахстан УДК 636.2:636.082 Е.С. УСЕНБЕКОВ, О.О. ЖАНСЕРКЕНОВА, Д.А. МЫРЗАКОЖА




(Казахский Национальный аграрный университет, г.Алматы) Авторами статьи для диагностики скрытых генетических дефектов у крупного рогатого скота: дефицита адгезии лейкоцитов BLAD (Bovine Leukocyte Adhesion Deficiensy), дефицита уридинмонофосфатсинтетазы DUМS (Deficiency of Uridine Monophosphate Synthase) и комплексного уродства позвоночника CVM (Complex Vertebral Malformation) у племенных быков-производителей был использован метод полимеразной цепной реакции (ПЦР) совместно с полиморфизмом длин рестриктых фрагментов (ПДРФ). Протестировано всего 28 быков-производителей ТОО «Байсерке-Агро» и СПХК ПЗ «Алматы», выявлено два гетерозиготных носителя мутации гена СД 18 – у быков голштинской породы. Среди исследуемой популяции быков носителей мутации DUМS и CVM не обнаружено.

Использование искусственного осеменения и трансплантации эмбрионов значительно повысило роль одного животного в распространении определенных полиморфных типов генов и генетических дефектов. Это приводит, с одной стороны, к снижению гетерозиготности стада, с другой к насыщению популяций летальными мутациями. Поэтому возникла необходимость более широкого использования молекулярно-генетических маркеров как инструмента для решения некоторых селекционных задач [1].

В настоящее время известно три мутации, встречающиеся у крупного рогатого скота BLAD, DUMS и CVM, вызывающие снижение резистентности организма, гибель эмбрионов и телят в первые месяцы постэмбрионального развития, различные уродства. Частота встречаемости мутантных аллелей BLAD варьируется в разных странах от 6-15% в США до 20% в Германии [2]. Это обстоятельство диктует настоятельную необходимость проведения строгого генетического контроля используемого генетического материала.

В 1983 году у крупного рогатого скота был описан дефицит уридинмонофосфатсинтетазы (DUMS) как моногенный аутосомно-рецессивный признак. Фенотипически мутация проявляется только у гомозиготных животных, вызывая гибель эмбрионов после 40 дней эмбрионального развития. С помощью специального теста у фенотипически нормальных гетерозиготных животных можно диагностировать снижение активности фермента. У лактирующих гетерозиготных коров можно обнаружить в молоке и моче наличие оротовой кислоты. После того, как у коров был выделен и описан ген уридинфосфатсинтетазы, установлено, что заболевание обусловлено точечной мутацией в кодирующей части этого гена, а точка мутации обозначена как R405Stop. Эта мутация ведет к исчезновению одного сайта рестрикции для фермента AvaI [3,4,5].

CVM (Complex Vertebral Malformation) комплексное уродство позвоночника - нарушение развития позвоночного столба, является летальной рецессивной мутацией у голштинского скота, выражается в мертворожденных, абортах, поражении телят, характеризуется укороченной шейной и грудной части позвоночного столба - впервые обнаружено у голштинского скота в Дании. Было найдено 2 элитных производителя, вследствие широкого использования семени этих производителей мутацию распространили во многих странах мира [6].

Одной из распространенных мутаций является дефицит адгезивности лейкоцитов (Bovine Leukocyte Adhesion Deficiensy, BLAD). Заболевание у крупного рогатого скота было впервые описано под названием "Гранулоцитарный синдром". Клинические симптомы проявления заболевания включали в себя предрасположенность к респираторной инфекции, диареи и низкую естественную резистентность организма к бактериальным инфекциям. Позднее было установлено, что заболевание обусловлено точечной мутацией в кодирующей части аутосомного гена CD18 [7].

Этот ген контролирует синтез гликопротеида B-интегрина, играющего ключевую роль в миграции нейтрофилов к очагу воспаления. Экспрессия В-интегрина требует межклеточной ассоциации субъединиц CD18 и CD 11. Точечная замена аденин-гуанин в 383 положении гена CD18 блокирует такую ассоциацию, так как приводит к аминокислотной замене последовательности соответствующей белковой молекулы (аспарагиновая кислота - глицин).

Эта мутация ведет к исчезновению сайта рестрикции для TaqI и появлению дополнительного сайта для HaeIII. К настоящему времени единственным методом, позволяющим безошибочно определять носительство мутации BLAD, DUMS и CVM в гетерозиготе, является амплификация участка гена с помощью специально подобранных праймеров, обработка полученных продуктов рестриктазами.

Материалы и методы исследования. Материалом для наших исследований послужила ДНК быков ТОО «Байсерке-Агро» и СПХК ПЗ «Алматы», выделенная из замороженной спермы по стандартной методике Bahnak.

Выделение ДНК из спермы. ДНК для амплификации выделяли из замороженной спермы быков-производителей по методу Bahnak [8].

Центрифугировали 1 мл спермы в течение 5 минут при 4000 g. Осевшие клетки промывали 0,15 М раствором NaCI, 2мМ ЭДТА и центрифугировали в течение 5 минут при 4000 g. Эту процедуру повторяли еще два раза. Затем, после последнего центрифугирования, верхний слой отсасывали с помощью пипетки, а к осадку добавляли лизирующий буфер Bahnak в количестве 5 мл, имеющий следующий состав: 6М гуанидинтиоцианат, 25 мМ цитрат натрия рН 7,0, 0,5% Sarcosyl, 0,1 М 2-меркаптоэтанол и инкубировали при 370С в течение 30 минут. Перед депротеинизацией лизированный раствор ДНК разбавляли 0,15 М раствором NaCL в соотношении 1:4. Депротеинизацию осуществляли по обычной методике, путем добавления равного объема смеси фенолхлороформ-изоамилового спирта (24:24:1). После центрифугирования осторожно отсасывали верхний слой пипеткой и осаждали в двух объемах 96% этилового спирта. Высушивали ДНК 2-5 минут под вытяжным шкафом и растворяли в буфере ТЕ.

Проведение полимеразной цепной реакции. Для проведения полимеразной цепной реакции в целях определения носителей BLAD использовали прямой -AGGCAGTTGCGTTCAACGTGA, обратный – CCGACTCGGTGATGCCATTGA праймеры. ПЦР проводили в общем объеме 50 мкл, содержащем 1-2 ед. Taq - полимеразы, по 0,25 mМ каждого dNTP, 67 mМ трис -HCl pH 8,6, 2,5 mM MgCl2, 16,6 mM NHOH. по 0,5 мкм каждого праймера и 100-150 нг ДНК. Программа включала в себя первоначальную денатурацию (95 С, 1 мин), 40 циклов, состоящих из следующих повторяющихся друг за другом этапов - денатурация - 95 С, 1 мин, отжиг праймеров - 62 С, 1 мин, синтез С, 1 мин; финальный синтез - 72 С, 5 мин. Полученный амплификат резали при помощи 3-4 ед.

рестриктазы TaqI. Обе цепи ДНК здоровых животных режутся с помощью указанного фермента. В итоге на электрофорезе мы видим два фрагмента - 100 п.н и 58 п.н. Ввиду того, что мутация ведет к исчезновению сайта рестрикции для Taq I ДНК животного, гетерозиготного по этой мутации, будет представлена в виде трех фрагментов 158 пар нуклеотидов( п.н.), 100 п.н., 58 п.н (Рис.1).

1 2 3 4 5 6 7M 8 9 10 11 12 13 Рис.1. Результаты ПЦР при аттестации быков на носительство генетического дефекта BLAD.

M – маркер pUC19 DNA/MspI; 2, 3, 4, 9-13 - норма; 1, 5, 6, 7 - носители мутации BLAD; 8 – гомозиготный носитель мутации BLAD; справа показана длина рестрикционных фрагментов.

На втором этапе те же быки типировались на носительство мутации DUMS. Для проведения полимеразной цепной реакции были использованы праймеры: прямой GAACATTCTGAATTTGTGATTGGT, обратный - GCTTCTAACTGAACTCCTCGAGT. Полученный амплификат резали при помощи 3-4 ед. рестриктазы AvaI. Обе цепи ДНК здоровых животных режутся с помощью указанного фермента в двух местах. В итоге на электрофорезе мы видим три Известия Национальной Академии наук Республики Казахстан фрагмента – 40, 36 и 19 п.н. Так как мутация ведет к исчезновению одного сайта рестрикции для AvaI, то ДНК животного, гетерозиготного по этой мутации, будет представлена в виде четырех фрагментов 76, 40,36 и 19 п.н.

Для диагностики комплексного уродства позвоночника (CVM) использовался метод ПДРФ анализа ПЦР продуктов. Замена G (дикий тип аллели) на T (CVM-аллель) приводит при использовании праймеров F 5’- CAC AAT TTG TAG GTC TCA CTG CA, R 5’- CGA TGA AAA AGG AAC CAA AAG GG к исчезновению сайта для рестриктазы PstI. При использовании праймеров F 5’CAC AAT TTG TAG GTC TCA ATG CA, R 5’- CGA TGA AAA AGG AAC CAA AAG GG появляется сайт рестрикции для EcoT22, выявляющий мутантную аллель.

Как показывают выполненные исследования, частота мутантного гена CD 18 в популяции быков голштинской породы в Алматинской области составляет 7 %, а быков - носителей мутации DUMS, CVM не выявлено. Рекомендуется учитывать в селекционной работе носительство генетических мутаций и проводить тестирование вновь поступающих быков и коров быкопроизводящей группы.


1.Яковлев А.Ф., Прохоренко П.Н. Cовременные тенденции использования генетики в животноводстве // Вестник РАСХН. 1997. № 2. С. 56–59.

2. Глазко В.И., Филенко А.П. Динамика распространения мутации BLAD (иммунодефицит) у крупного рогатого скота.1999, Доклады РАСХН, 2, 41-43.

3.Robinson J.L., Drabik M.R., Dombrowski D.B., Clark J.H. Consequences of UMP synthase deficiency in cattle. // Proc.

Natl. Acad. Sci. USA. V.80. P.312-323.

4.Harden K.K., Robinson I.L. Charakterisation of UMFS in dairy cattle heterozygouos for a lethal recessive trait.// Biochem. Genet. V.25. P.465-475.

5.Robinson J.L., Dombrowski D.B., Clark J., Shanks R.D. Oratate in milk and urine of dairy cows with a partial deficiency of UMFS. // J.Dairy Sci. V.67. P. 1024-1029.

6.Tammen I., Klippert H., Kuczka A., Treviranus A., Pohlenz J., Stober M., Simon D., Harlizlizius B. 1996. Am impoved DNA test for bovine leukocyte adhesion deficiency. Research in Veterinary Science 60, 218-221.

7. Shuster D.E., Kehrli M.E., Achermann M.R., Gilbert R.O., 1992, Identification and prevalence of a genetic defect that causes leukocyte adhesion deficiency in Holstein cattle. Proc.Natl.Acad.Sci.USA, 89(19), 9225-9229.

8.Bahnak B.R. A single and efficient vethod for isjlating high molecular weight DNA from mammalian sperm.// NAR. J Veter. Medic. Sci.. 1993 V.55.-p. 145-156


–  –  –

Iрі ара малында кездесетін жасырын генетикалы кемтарлытарды анытауа: лейкоциттер адгезиясыны дефицитін BLAD (Bovine Leukocyte Adhesion Deficiensy), уридинмонофосфатсинтетаза дефицитін DUМS (Deficiency of Uridine Monophosphate Synthase) жне омыртаны кешенді кемтарлыын (Complex Vertebral Malformation) асыл тымды баларда анытауа полимеразды тізбек реакциясымен (ПТР), бірге рестриктік фрагменттер зындытарыны полиморфизмін пайдаланан (РФП). Барлыы «Байсерке-Агро» ЖШС мен АШК «Алматы» асыл тымды шаруашылыында 28 ба тексеруден ткізілген, соны ішінде екі бада – СД 18 мутациялы геніні гетерозиготалы тасымалдаушылары аныталан. Зерттелген балар популяциясында DUМS жне CVM тым уалаушы балар табылмаан.

–  –  –

By the authors of the article for diagnostics of latent genetic defects at a cattle: deficit of adhesion of leucocytes of BLAD (Bovine Leukocyte Adhesion Deficiensy), deficit of uridine monophosphate synthase DUМS (Deficiency of Uridine Monophosphate Synthase) and complex deformity of backbone of CVM (Complex Vertebral Malformation) for tribal bulls-producers the method of polymerase chain reaction (PCR) was used jointly with polymorphism of lengths of restriction fragments (RLFP). Only 28 bulls-producers of "Baiserce-Аgro" and "Аlmary", are tested it is educed two heterozygous carriers of mutation of gene of СД 18 are bulls of Holstein breed. Among the investigated population of bulls of carriers of mutation of DUМS and CVM not found out.

№ 6. 2011 Вопросы лечения и диагностики незаразных заболеваний сельскохозяйственных животных УДК 619:618 (075.8) М. ДЖУЛАНОВ, Н. ДЖУЛАНОВА



–  –  –

Приводятся сведения по распространенности нарушений проводимости яйцеводов. Авторами изучены существующие способы диагностики указанной патологии и предлагается новый способ определения нарушений проходимости яйцеводов у коров и телок, предусматривающий проведение процесса продувания просвета яйцеводов в стадию возбуждения полового цикла, при котором происходит естественное раскрытие канала шейки матки с сохранением сократительной способности мускулатуры матки и яйцеводов. Процедура продувания выполняется специальным аппаратом для пертубации яйцеводов, разработанным также авторами данной работы. Также в работе указывается, что диагностическое продувание яйцеводов перед осеменением повышает оплодотворяемость у коров и телок. Проведен сравнительный анализ и дана оценка эффективности рекомендуемого и существующего способов диагностики нарушений проводимости яйцеводов.

Половой аппарат самок, кроме половых желез, состоит из органов, представляющих трубчатый вид, имеющих абдоминальные и каудальные отверстия [1]. В различные периоды физиологического состояния в них проходят жизненно важные процессы, связанные с воспроизводством потомства. По различным причинам проходимость органов полового аппарата может нарушаться [2, 3]. Так, например, при атонии и гипотонии матки в них скапливаются секреты маточных желез, особенно в абдоминальной части, закрывающие просвет яйцеводов. В основном эта патология отмечается у телок случного возраста, при задержании желтого тела полового цикла, отсутствии моциона, патологии в гениталиях, а также у коров по завершении послеродового периода, при различных формах метрита, особенно хронических и скрытых. Поэтому определение степени проходимости яйцеводов у коров и телок является как диагностическим, так и профилактическим приемом в акушерстве и гинекологии [4].

Существующий способ определения состояния яйцеводов путем продувания ее просвета трудоемок в выполнении в производственных условиях, так как предусматривает проведение излишних манипуляций, связанных с фиксацией животного в станке и с вставлением катетера в канал шейки матки (искусственного раскрытия канала, введение влагалищного зеркала, захвата щипцами шейки матки и подтягивание ее к половой щели, обработка устья шейки настойкой йода, вставление обтуратора в канал и фиксация катетера к щипцам). При проведении этих процедур наносятся травмы, происходит разгерметизация шейки матки, а также наблюдаются спазмы влагалища, матки и яйцеводов, вследствие попадания воздуха в их полости, особенно в холодное время года, что отражается на результатах исследования. Кроме того, данный способ требует наличия дополнительных приспособлений (влагалищное зеркало, щипцы для фиксации шейки матки) и препаратов (спазмолитики, 5% настойка йода).

Исходя из вышеуказанных недостатков известного способа, нами предложен способ диагностики нарушений проходимости яйцеводов у коров и телок, предусматривающий проведение процесса продувания просвета яйцеводов в стадии возбуждения полового цикла, при котором происходит естественное раскрытие канала шейки матки с сохранением сократительной способности мускулатуры матки и яйцеводов.

Процедура продувания выполняется разработанным нами специальным аппаратом – ДК-1, включающим катетер, манометр, шары Ричардсона. При этом катетер выполнен из резины повышенной упругости и эластичности, на которой имеется двойная трубка, Известия Национальной Академии наук Республики Казахстан одна из которых открывается на конце катетера, а вторая подсоединена к воздушной манжетке, расположенной в передней части катетера в виде надувного баллончика для герметичного закрытия шейки матки. К катетеру подсоединяется толстостенная емкость с теплым раствором фурациллина.

Предлагаемый способ осуществляется следующим образом: коров и телок, подлежащих обследованию в стадии возбуждения полового цикла, фиксируют в стойле, после обработки наружных половых органов и промежности пальцами рук фиксируют половые губы и раскрывают преддверье влагалища животного, вводят стерильный катетер пертубатора во влагалище по верхней стенке до упора в свод влагалища. Рукой через прямую кишку фиксируют шейку матки и под его контролем вводят в просвет канала шейки матки катетер пертубатора так, чтобы конец катетера выступал в просвет тела матки на 5-6 см, при этом резиновая манжетка катетера пертубатора будет находиться в канале шейки матки. Далее, через катетер для наполнения резиновой манжетки и герметичного закрытия канала шейки матки вводят 50-55 мм3 воздуха, а затем с помощью шаров Ричардсона в полость матки постепенно нагнетают воздух, который, проходя через подогретый стерильный раствор фурациллина в разведении 1:5000, обеззараживается и в теплом виде поступает в полость матки, не вызывая спазма матки и яйцеводов. Учет результатов проводят также, как и при известном способе.

Способ был апробирован на 132 клинически здоровых коровах и телках, СХПК ПЗ «Алматы», ТОО «Байсерке АГРО», ТОО «Айршир» Талгарского района Алматинской области, имеющих 5 и более осеменений, проведены исследования по определению состояний яйцеводов предлагаемым (опытная группа) и существующим (контрольная группа) способами. При апробации заявляемого способа (рис.1) диагностическую процедуру полностью удалось осуществить на 95,5% обследованных животных (42 гол.), при этом нормальная проходимость яйцеводов установлена у 18,2% (8 гол.), нарушение односторонней проводимости- у 41,0%, двусторонней- у 36,3% животных. Осложнений после диагностической процедуры у животных данной группы не было. Тогда как при предлагаемом способе (первая контрольная группа) процедуру удалось провести у 40,9% (18) животных. Причиной низкой эффективности существующего способа явилось нарушение герметичности шейки матки после применения спазмолитических средств. Вместе с тем у 72,7% животных контрольной группы после процедуры пертубации наблюдались цервициты и эндометриты, как следствие манипуляции, связанные с фиксацией обтуратора на шейке матки и обострении скрытых воспалительных процессов.

На проведение одной диагностической процедуры заявляемым способом затрата времени специалиста было в три раза меньше (4 минуты) по сравнению с существующим способом (12-14 минут).

№ 6. 2011 59,1 36,3 20,4 18,2 11,4 9,1 10 4,5

–  –  –

Применение предлагаемого способа пертубации яйцеводов перед осеменением животных повышает процент оплодотворяемости. Так, перед осеменением 86 клинически здоровым коровам провели продувание яйцеводов заявляемым и 42 существующим способами. Предлагаемым методом продувание яйцеводов удалось осуществить у 97,7% животных (опытная группа), тогда как при существующем методе продувание удалось провести у 83,3% (контрольная группа). Продувание яйцеводов заявляемым способом повысило оплодотворяемость коров на 24,1% по сравнению с существующим.

Таким образом, разработанный нами способ определения состояния яйцеводов у коров и телок, включающий введение катетера, герметизацию канала шейки матки и вдувание воздуха в полость матки, отличается от известных тем, что с целью повышения эффективности способа процедуру продувания рекомендуем проводить при естественном раскрытии канала шейки матки - в стадии возбуждения полового цикла. При проведении данной процедуры не нарушается тонус мускулатуры матки и яйцеводов, введение катетера в канал шейки матки контролируется рукой через прямую кишку, а цервикальный канал закрывается герметично надувным баллончиком, расположенным на катетере. Воздух, вводимый в матку для продувания яйцеводов, обеззараживается и подогревается при прохождении через стерильный, теплый раствор фурацилина.

В стадию возбуждения полового цикла организм самки создает благоприятные условия для осуществления диагностических, лечебных и профилактических процедур. Например, раскрытие канала шейки матки, повышение тонуса мускулатуры половых органов, создаются благоприятные условия для восстановления проводимости яйцеводов (мерцание эпителия, ток жидкости, секреция маточных желез, отрицательное давление, создающееся в полости матки). Помимо этого, за счет обильного притока крови в половой аппарат усиливаются обменные процессы, при котором обостряются скрытые и хронические воспалительные процессы, легко устанавливаемые при тщательном гинекологическом обследовании животного.

Известия Национальной Академии наук Республики Казахстан


1. Студенцов А.П., Шипилов В.С., Никитин В.Я., Миролюбов М.Г., Субботина Л.Г., Преображенский О.Н., Храмцов В.В. Ветеринарное акушерство, гинекология и биотехника размножения. – М.: Колос, 2000. – 495 с.

2. Зверева Г.В., Олескив В.Н., Хомин С.П. и др. Справочник по ветеринарному акушерству, Киев «Урожай» 1986.

3. Контроль воспроизводства сельскохозяйственных животных. Под ред. проф. М.Д. Орлова. М. Агропромиздат 1988. 415-с.

4. Джуланов М.Н. Коррекция нарушений репродуктивной функции при искусственно-приобретенном и симптоматическом бесплодии у коров и телок. // Автореф. дисс. на соиск. уч.степ. доктора вет. наук., Алматы 2007 г. 34-с.

–  –  –

Аталан жмыста ры ттікшелеріні ткізгіштігіні бзылуыны таралуы туралы мліметтер берілген.

Авторлар осы патологияны анытауды азіргі тада олданатын балау дістерін зерттеген жне сиырлар мен нажындарда ры ттікшелеріні ткізгіштік асиеттерін анытауды жаа дісін, жынысты циклді озу сатысы кезінде, жатыр мойыны табии ашылан кезде жатыр еттері мен ры ттікшелеріні жиырылу абылетін сатай отырып, ры ттікшелерін рлеу арылы балау жасау. рлеу рдісі, пертубация, осы жмысты авторлары ойлап тапан, арнайы ралды кмегімен жзеге асырылады. Сонымен атар жмыста крсетілгендей, балау масатымен жасалан ры ттікшелерін рлеу сиырлар мен нажындарда рытану абылетін жоарылатады.

–  –  –

In the given work data on prevalence of infringements of conductivity uterine tube are resulted. Authors study existing ways of diagnostics of the specified pathology and the new way of definition of impassability tube are at cows and first heifer, providing carrying out of process of blowing off of a gleam uterine tube in a stage of excitation of a sexual cycle at which there is a natural disclosing of the channel of a neck of a uterus to preservation reduction abilities of muscles of a uterus and uterine tube is offered. Blowing off procedure is carried out by the special device for blowing off uterine tube, developed also authors of the given work. Also in work it is underlined that diagnostic blowing off uterine tube before insemination raises breeding effeciency at cows and first heifer.

№ 6. 2011 УДК 619:614:9:616 О.Т.ТРЕБЕКОВ



–  –  –

азастан Республикасыны малшаруашылыыны негізгі салаларыны бірі – ой шаруашылыы. Осы сала бойынша шешімін таппаан мселелер жеткілікті, оны ішінде рытандыру кезіндегі аталы малды шуетіні нашарлыы, саулытарды жпалыемес іштастауы жне аналы малды кйге келгенде табии жне олдан рытанбай алуы. Осы трыдан аланда дені сау тл алып, мал німін жасарту шін аналы жне аталы мал басын рытандыру науанына дрыс дайындауды маызы зор. Сондытан аталы жне аналы малды рытандыру науанына екі ай брын дайындаан дрыс. Малды рационында 30 пайыз жануар тектес белоктар боланы жн, сапалы жем, жмырта, сбіз, жоыша рацион бойынша берілгені жн.[1] Таырыпты зектілігі Республика малшаруашылыыны негізгі салаларыны бірі- ой шаруашылыы. Осы сала бойынша шешімін таппаан мселелер жеткілікті, оны ішінде рытандыру кезіндегі аталы малды шуетіні нашарлыы, саулытарды жпалыемес іштастауы жне аналы малды кйге келгенде табии жне олдан рытанбай алуы. Осы трыдан аланда дені сау тл алып, мал німін жасарту шін аналы жне аталы мал басын рытандыру науанына дрыс дайындауды маызы зор.

Жмысты масаты ретінде рытану науаны кезінде аталы жне аналы малды клиникалы зерттеуден ткізіп, шуетіні сапасын анытаумен атар зімізді технологиямыз бойынша дайындалан азыты оспаны тиімділігін анытау болып табылады.

Жмыста пайдаланан дістер Мал басын гинекологиялы жне андрологиялы диспансеризациядан ткізу. Гинекологиялы диспансеризацияны арнай зерттеулер жргізу арылы іске асырды- ол шін саулыа арналган ынап айнасымен ынаптын, жатыр мойныны клегей абатыны жадайын зерттедік. Андрологиялы зерттеу кезінде аталы малды жынысты рефлексін тексеріп, жыныс мшесін клиникалы зерттеуден ткізіп, шуетіні сапасын арнайы дістермен тексердік.[4] Малды рытану науаны кезінде белгілі рационмен атар зіміз дайындаан азы оспасын беріп отырды. Азы оспасы тменгі діс бойынша дайындалды- ара бидай ны, ра жем, са ант, 1,5-2 литр балы майы, ра нан ашытысын араластырып жылы су йып, 3-5 кнге ащытуа ойып, кейін бошке суын толтырып, азы оспасын малдын жеміне бір баса орта есеппен 0,5 литрден осып,араластырып беріп отырды Зерттеу нтижесі Аталы жне аналы малды рытандыруа дайындау Аталы малды 1,5-2 ай брын андрологиялы диспансеризациядан ткізеді. Жалпы денсаулыын жне жыныс мшелеріні ызметін клиникалы зерттеуден ткізеді. Кйекке тсетін ошар рационы 2-3 дана тауы жмыртасынан, 1-2 литр сттен, 1 кг сбізден, 500-600 гр сапалы жемнен трады, ет-сйек нтаы т.б. осылады.

Известия Национальной Академии наук Республики Казахстан

–  –  –

Жалайтын тз, сонымен атар 2-3 саат моциона жне тстен кейін жайылыма шыару ажет. Асыл тым ошарларды шует сапасын немі тексеру ажет. Аналы мал басын рытандыру науаны басталмастан брын індетті жне инвазиялы ауырулара зерттейді. Кйге келген аналыты сапалы жылы шуетпен асептика жне антисептика ережелерін сатай отырып рытандырады, наты сапалы азыпен жылы орамен амтамасыз етеді. [5]

–  –  –

ртрлі соыдан болатын іштастауды алдын алу шін малды ке ора-жайда ветеринарлы-зоогигиена ережелеріне сйкес баып ктеді. Бір малорада 500-800 бастан арты стауа болмайды. Мал ораны иын уаытында тазартан дрыс, йткені иды ызуымен мал организмі ыстыа, ал далаа шыанда суыа рынып, аналы мал іштастауы ммкін.

Біз Алматы облысы арасай ауданындаы зын-аралы шаруашылыында мал басын кбейту шін бірнеше іс-шараларды жргіздік, атап айтса малды гинекологиялы-андрологиялы диспансеризациядан ткіздік, аталы ошарларды шуетін 2 ай ішінде 20 рет сапасын тексердік, саулытарды рытануын жне жпалы емес іштастауыны алдын алу шін зімдік технология бойынша дайындалан азыты оспаны аталы жне аналы малды рационына осып кніне 2 рет жем берген сайын 0,3-0,5 литрден беріп отырды Азыты оспаны пайдалану нтижесінде ошарларды шуетіні сапасы жасарды. [2] 3 кесте. Азыты оспаны негізгі рациона осымша пайдаланандаы ошар шуетіні сапасыны згеруі

–  –  –

Зерттеу жмыстары Алматы облысы арасай ауданына арасты «зын-аралы» шаруа ожалыында жргізілді. Мал басын кбейту іс-шаралары атарында зімізді технология бойынша дайындалан азыты оспаны пайдаланды, соны нтижесінде ошар шуетіні сапасыны белсенділігі 0,75 тен 0,85 дейін артты, яни 44,2 %; спермилер міршедігі 29,7 %-а ктерілді жне шуетті консентрациясымен млшеріде жасарды.

олдан рытандырудан бір ай брын аналы малды екі топа бліп, бірінші тжірибе тобындаы малды рационына осымша азыты оспаны 0,5 л ден беріп отырды, ал екінші топтаы малды тек белгілі рационмен азытандырды. Ал олдан рытандыру кезінде екі топтаы малды біріктіріп, олдан визо-цервикалді діспен рытандырды, нтижесінде тжірибе тобындаы саулытарды рытану пайызы 94% дейін ктерілді, ал баылау тобында 88,6 % болды. Тлдеу крсеткіші тжірибе тобында 120,2 %, баылау тобында 109 % жетті, осымша 10 озы алынды.

Бізді технология бойынша азыты оспа тменгі ретпен дайындалды:

- ара бидай ны, жем, са ант 1,5-2 л балы майы жне ра ашытыны пайдаланып жылы са араластырып 3кн ішінде ашыты оспа дайын болады.

Содан кейін бшке дегейін 200 л толтырып азыты оспаны бір мала 0,5 литрден жемге осып беріп отырды. Азыты оспа мес арындаы ашу процессін жасартып, мал организміне осымша оректік заттармен амтамасыз етеді, азыты ортылуына, сіуіне з септігін тигізеді. [3] Азыты оспа азастан Республикасы ділет минимстрлігіні зияткерлік меншік ыы жніндегі комитетте тіркелген, тіркеу №18393 Жоарыдаы айтыланды орытындылай келе тменгі тжырым жасады.

1. Мал басын кбейту жне олдан рытандыру жмысын жасарту шін жаа технология бойынша дайындалан азыты оспаны пайдалану ажет.

2. Азыты оспаны пайдалану нтижесінде ошар шуетіні сапасы жасарып, саулытарды рытануы 94 %-а, оздауы 92,8 % ктеріледі жне 10 бас осымша тл алынды.

3. Жаа технология бойынша дайындалан азыты оспаны ой шаруашылыында пайдалануа сынамыз.


1.Студенцов А.П. «Борьба с яловостью и бесплодием с/х животных»// Издательство «Знание», 1965., С.125.

2. Ильясов Б.К., Туребеков О.Т., Джуланов М.Н. «Мал басын бейту жне оны бедеулігімен крес щаралары» // Жаршы №6-2006,.49 бет.

3. Туребеков О.Т. «Практические мероприятия по повышению плодовитости овец» // Вестник Семипалатинского гос.университета им. Шакарима,2006, С. 9-10.

4.Толмачев А.Н. «Повышение многоплодия овец». // Изд. КФАН Алматы,1989, с.19.

5. Оналбаев А., Окуличев Г.А., «Влияние улучшенного кормления овец на их плодовитость». // Овцеводство-1978, с.22.


В данной статье рекомендуется применение кормодобавки приготовленный по новой технологии в овцеводстве Одним из отраслей животноводства в Республике Казахстан,является овцеводство.Однако имеются ряд нерешенных проблем в данной отрасли,одним из которых, является низкое качество спермы баранов-производителей во время осеменения маток, аборты незаразного происхождения, несвоевременное осеменение маток искусственным и естественным путем. Всвязи с этим залогом получения качественного полноценного приплода и качественной продукции сельского хозяйства, является тщательная подготовка маток и производителей к случной компании- улучшение качества кормления и содержания, ислючение инфекционных заболевангии и болезней передающихся половым путем, разработка мероприятии по улучшению воспроизводительных функции животных.


One of the livestock industries in the Republic of Kazakhstan, is sheepen. However, there are some unresolved issues in the industry, one of which is low quality sperm producing rams during the insemination of females, abortion, non-contagious origin, delayed insemination of females by artificial and natural. This makes it important key to producing high-quality fullfledged offspring and quality of agricultural products, is thorough preparation and Mares producers to the breeding company.

Мероприятия по повышению качества спермы баранов-производителей и плодовитости овец

–  –  –

Приведены данные результатов исследования при лечении гнойных ран у крупного рогатого скота, полученным на кафедре новым препаратом – мазью Прокан. Работа проводилась в условиях животноводческих хозяйств Алматинской области и на кафедре акушерства, хирургии и биотехнологии воспроизводства Казахского Национального аграрного университета. В опыте были использовано 8 голов крупного рогатого скота различных половозрастных групп, имеющие гнойные раны. Позитивные клинические изменения у подопытных животных проявляются на 5 – 7 сутки от начала лечения, на 12 - 15 сутки клиническое состояние подопытных животных полностью нормализуется.

В настоящее время внимание исследователей привлечено к проблеме заживления гнойных ран. Высокая обсемененность тканей раны препятствует заживлению. Некоторые бактерии и их специфические токсины (например, эндотоксин синегнойной палочки) даже в небольшом количестве представляют серьезную проблему [1.2]. По данным ряда авторов, освобождающиеся в ходе развития инфекционного процесса медиаторы воспаления (в особенности кислородные продукты, протеазы, цитокины), принимают участие не только в антибактериальной защите, но и оказывают повреждающее действие на организм. В этой связи при лечении гнойных ран используются антиоксиданты, ингибиторы протеолитических ферментов, антитела к цитокинам [3. 4].

Несмотря на интенсивную разработку и широкое применение самых разнообразных антибактериальных препаратов, частота нагноений случайных и послеоперационных ран не уменьшается, оставаясь на протяжении последних десятилетий на уровне 38 – 46 % [5, 6]. Общеизвестно, что успех в лечении гнойных ран зависит от состояния биологии заживления раны; фазы раневого процесса, выбора наиболее эффективных и адекватных способов лечения.

Целью проведенных исследований было сравнительное изучение динамики клиникоморфологических показателей крови при лечении гнойных ран у крупного рогатого скота.

Материалы и методы исследования. Работа проводилась в условиях животноводческих хозяйств Алматинской области и на кафедре акушерства, хирургии и биотехнологии воспроизводства Казахского Национального аграрного университета. В опыте были использовано 8 голов крупного рогатого скота различных половозрастных групп, имеющие гнойные раны. Раны были получены в результате травмирования и представляли собой резанные, рваные, размозженные со сроком давности от 1 до 18 суток.

Животные до эксперимента неоднократно получали лечение, однако заживление не происходило. Раны были осложнены инфекцией и протекали хронически. На ранах имелись патологические разрастания соединительной ткани, обширные твердые воспалительные отеки.

Животным в опытной группе применяли полученный на кафедре новый препарат - мазь «Прокан», содержащий в своем составе канифоль, прополис, мед, растительное масло и мыло.

Препарат экологически чистый, не содержит сильнодействующих химических ингредиентов. В контрольной группе животных лечили ихтиоловой мазью и дополнительно применяли антибиотик цефазолин. Заживление ран происходило по вторичному натяжению без наложения швов как в контрольной, так и в опытной группах.

Статистическую обработку полученных результатов провели константным методом математического анализа количественных показателей по Сазовскому. Уровень достоверности определяли с помощью критерия Стьюдента-Фишера.

Результаты исследования. Результаты исследования динамики клинико-морфологического статуса животных при лечении приведены в таблицах 1 и 2. У подопытных животных на 5 сутки по сравнению с контрольными число эритроцитов увеличилось на 15,9 %. После проведения лечения у подопытных животных на 7 и 10 сутки эритроциты повысились на 31,6 %, на 14 сутки - на 29,3 %, на 21 сутки - на 14,9 %, по сравнению с первоначальными показателями.

№ 6. 2011 Количество гемоглобина уменьшилось на 3 сутки от начала лечения на 6,2 %, на 5 сутки - на 4,5 %, на 10 сутки количество было в пределах нормы.

У контрольных животных по сравнению с подопытными животными общее количество лейкоцитов увеличилось после применения ихтиоловой мази на 38,4 %. У подопытных животных на 5 и 7 сутки от начала лечения наблюдалось увеличение лейкоцитов на 43,8 %. На 10 сутки этот показатель составил 27,4 %, а на 14 сутки - 17,5 %.

Общий белок сыворотки крови у подопытных животных увеличился на 3 сутки от начала лечения на 11,5 %, на 5 сутки – на 23,2 %, на 7 сутки - на 18,2 %, на 14 сутки - на 14,8 %. На 19 сутки уровень был в пределах исходных показателей.

Обсуждение результатов исследования. Проведенными исследованиями установлено, что лечение мазью «Прокан» существенно улучшает клинико - морфологическое состояние больного животного, ускоряет процесс заживления раны. Позитивные клинические изменения у подопытных животных проявляются на 5 – 7 сутки от начала лечения, а на 12 - 15 сутки клиническое состояние подопытных животных полностью нормализуется.


1. М.И. Кузин. Заживление ран в клинике и эксперименте. М.:Медицина, 2002. С. 26-28.

2. Ross, R. С. Strains posses specific adhesins for laminin. //Infect. Imm, 1998. N 6.. P. 58-60

3. Борисевич В.Б., Смиронов А.М. Раневой процесс и закономерности заживления ран// Ветеринария. 1999. №5, С 48-52.

4. Давыдовский И.В. Диагностика и лечение ранений. М.: Медицина, 1990. С. 128-131

5. Глянцев С. П. Хроническая рана от Мечникова до наших дней. //Врач. дело, 1997. N 8. с. 34-36

6. Данилина Е. М., Писаржевский С., А.,Дудникова Г. Н., Карелин А.А. Роль микробного фактора, некротических масс и инородного тела в развитии гнойного процесса в ранах. Бюлл. эксп. биол. и мед., 2003. N 3. с. 31-34


–  –  –

Ірі ара малыны іріді жараларын емдеудегі зерттеу мліметтері келтірілген. Кафедрада алынан жаа препарат «Прокан» жапа майымен емдеу жргізілген. Зерттеу жмыстары азАУ-да жне Алматы облысыны мал шаруашылытарында жргізілді. Жмыса 8 бас ірі ара малы алынды, олар р трлі жастаы жне р трлі жынысты болды. Препаратты олдану барысында ол жараны жазылуына ыпал ететіні аныталды. Жараны жазылуы жалпы алыптасан еммен салыстыранда 5-7 тулікке ерте жрген, ары арай 12-15 туліктерде толыымен алыптасып болан.

–  –  –

This article the data of results of research is cited at treatments of purulent wounds at a horned cattle by the new preparation received on chair, ointment "Prokan". Experiences were spent in KazNAU and in economy of Almaty area, 8 goals of a horned cattle various ages groups having purulent wounds have been used. By the spent researches it is established that treatment by ointment "Prokan" sushchest-venno improves клинико - a morphological condition of a sick animal, accelerates process of healing of a wound. Positive clinical changes at experimental animals are shown on 5 – 7 days from an initiation of treatment, further on 12 - 15 days a clinical condition of experimental animals completely.

Известия Национальной Академии наук Республики Казахстан Таблица 1. Динамика клинико-морфологических показателей крови у подопытных животных

–  –  –

№ 6. 2011 НАШИ АВТОРЫ Асанов Нигмет Гатауович – доктор ветеринарных наук, профессор, КазНАУ Омарбекова Уржан Жакатаевна – кандидат ветеринарных наук, доцент, КазНАУ Бияшев Кадыр Бияшевич – доктор ветеринарных наук, профессор, КазНАУ Киркимбаева Жумагуль Слямбековна – доктор ветеринарных наук, профессор, КазНАУ Бияшев Биржан Кадырович – доктор ветеринарных наук, профессор, КазНАУ Ермагамбетова Светлана Емлсовна – кандидат ветеринарных наук, доцент, КазНАУ Макбуз Аманжол Жасбилимович – доктор ветеринарных наук, доцент, КазНАУ Сарсембаева Нуржан Билтибаевна – доктор ветеринарных наук, профессор, КазНАУ Шабдарбаева Гульнар Сабыровна – доктор биологических наук, профессор, Почетный академик НАН РК, КазНАУ Балгимбаева Айжан Ильясовна – кандидат ветеринарных наук, КазНАУ Джанабекова Гульмира Кумискалиевна – кандидат ветеринарных наук, доцент кафедры физиологии, морфологии и биохимии имени академика Н.У.Базановой КазНАУ Ильгекбаева Г.Д. – доктор ветеринарных наук, доцент кафедры биологической безопасности КазНАУ Отарбаев Б.К. – кандидат ветеринарных наук, старший преподаватель кафедры биологической безопасности КазНАУ Шыныбаев К.М. – кандидат ветеринарных наук, начальник отдела биологического контроля ТОО “НПЦ ДиаВак-АБН” Амантаева М.Э. – магистрант кафедры биологической безопасности Казахского национального аграрного университета Сарсембаева Нуржан Билтебаевна – доктор ветеринарных наук, профессор, заведующая кафедрой ВСЭ и гигиены Паритова Асел Ержановна – PhD докторант 1-го курса КазНАУ Слямова Аяна Ерлановна – магистрант 2-го курса КазНАУ, Сулейменов Тлеубек Табылдиевич – доктор ветеринарных наук, профессор, КазНАУ Ахметова Глнази Даулетхановна – кандидат биологических наук, ст.преподаватель КазНАУ Мусоев Асылбек Маилибоиевич – магистр ветеринарных наук, КазНАУ Тусипхан Оралхан – магистрант КазНАУ Тулемисова Жанара Кенесовна – доктор биологических наук, профессор, КазНАУ Ерназарова Сандугаш Тукеновна – кандидат ветеринарных наук, КазНАУ Турганбаева Гульнар Елдесбаевна – кандидат ветеринарных наук, старший преподаватель КазНАУ Усенбеков Есенгали Серикович – кандидат биологических наук, доцент КазНАУ Жансеркенова Орик Оразимановна – кандидат ветеринарных наук, руководитель учебно-научно-диагностической лаборатории КазНАУ Мырзакожа Диас Асылбекович – доктор химических наук, директор Казахско-Японского центра КазНАУ Джуланов Мардан – доктор ветеринарных наук, профессор, КазНАУ Джуланова Нурсулу – магистр ветеринарных наук, докторант, КазНАУ Туребеков Орынбасар Тиштибаевич – кандидат биологических наук, доцент, КазНАУ Махмутов Абзал Касенович – кандидат ветеринарных наук, ассиcтент, КазНАУ Известия Национальной Академии наук Республики Казахстан МАЗМНЫ

–  –  –

Асанов Н.Г., Омарбекова У.Ж азастандаы нерксіптік сшаруашылыыны биологиялы ауіпсіздігі

Бияшев К.Б., Киркимбаева Ж.С., Ермагамбетова С. Е., Бияшев Б.К., МакбузА.Ж.,Сарсембаева Н.Б. Бактерицин ндіруші e. coli штамыны озы организмі табии резистенттілігіні клеткалы факторларына тигізетін серін анытау..6 Шабдарбаева Г.С., Балымбаева А.И. антоышарлы ауруларды балауды жадайы*

Джанабекова Г.К. Сальмонеллезге арсы трлі вакциналарімен иммундалан бзау аны сарысуыны иммундалана дейін жне иммундаланнан кейінгі g2 иммундыглобулинні амин ышылды рамы

Ілгекбаева Г.Д., Отарбаев Б.К., Шыныбаев К., Амантаева М.Э. Сайдулдин реакциясын ой бруцеллезі кезінде ндірістік сынатан ткізу

Сарсембаева Н.Б., Паритова А.Е., Слямова А.Е. Анизакидоз ауруы кезінде балыты ветеринариялы-санитариялы сараптауы

Сулейменов Т.Т.,МусоевА.М., Ахметова Г.Д. Ірі ара пироплазмозыны таралу ерекшеліктері

Тлемісова Ж.К., Шабдарбаева Г.С., Ерназарова С.Т., Транбаева Г.Е. с шаруашылыында пробиотиктерді олдануды жаа тсілі

Усенбеков Е.С., Жансеркенова О.О.,. Мырзакожа Д.А. Асыл тымды жануарларда жасырын генетикалы кемтарлыты днк-технологиясын пайдалану арылы анытау

Жпалы емес ауруларды емдеу жне балау мселелері

Джуланов М., Джуланова Н. Сиырлар мен нажындарда ры ттікшелеріні ткізгіштігін анытау

Туребеков О.Т. ошарларды шуетіні сапасын арттыру жне саулытарды тлшендігін жасарту іс-шаралары........49 Махмутов А.К. Жануарларды іріді жараларын емдеу

№ 6. 2011 СОДЕРЖАНИЕ

–  –  –

Асанов Н.Г., Омарбекова У.Ж. Вопросы биологической безопасности в промышленном птицеводстве Казахстана..........3 Бияшев К.Б., Киркимбаева Ж.С., Ермагамбетова С. Е., Бияшев Б.К., МакбузА.Ж.,Сарсембаева Н.Б. Определение влияния бактерицинпродуцирующих штаммов E.coli на клеточные факторы естественной резистентности организма ягнят……

Шабдарбаева Г.С., Балгимбаева А.И. Состояние диагностики кровепаразитарных болезней животных*……………………………..11 Джанабекова Г.К. Аминокислотный состав иммуноглобулина g2 сыворотки крови телят до и после иммунизации разными вакцинами против сальмонеллеза

Илгекбаева Г.Д., Отарбаев Б.К., Шыныбаев К., Амантаева М.Э. Испытание реакции Сайдулдина при бруцеллезе овец в производственных условиях

Сарсембаева Н.Б., Паритова А.Е., Слямова А.Е. Ветеринарно-санитарная экспертиза рыб при анизакидозе

Сулейменов Т.Т., МусоевА.М., Ахметова Г.Д.Особенности распространения пироплазмоза крупного рогатого скота…………30 Тулемисова Ж.К., Шабдарбаева Г.С., Турганбаева Г.Е., Ерназарова С.Т. Новый способ применения пробиотиков в птицеводстве……………………………………………………

Усенбеков Е.С., Жансеркенова О.О.,. Мырзакожа Д.А. Использование ДНК-технологии для элиминации скрытых генетических дефектов у племенных животных

Вопросы лечения и диагностики незаразных заболеваний сельскохозяйственных животных Джуланов М., Джуланова Н. Диагностика проходимости яйцеводов у коров и телок……………………………………45 Туребеков О.Т. Мероприятия по повышению качества спермы баранов-производителей и плодовитости овец................49

Pages:     | 1 ||
Похожие работы:

«Анисимов, О.А., Лавров, С.А., 2004. Глобальное потепление и таяние вечной мерзлоты: оценка рисков для производственных обьектов ТЭК. Технологии ТЭК (3): 78-83. Глобальное потепление и таяние вечной мерзлоты: оценка рисков для производственных объектов ТЭК РФ Олег Анисимов, д.г.н., Государственный гидрологический...»

«БОГОСЛОВСКИЕ ТРУДЫ, XI ПУБЛИКАЦИИ В ПОХВАЛУ ПРЕПОДОБНОМУ СЕРГИЮ, ИГУМЕНУ РАДОНЕЖСКОМУ, ВСЕЯ РОССИИ ЧУДОТВОРЦУ (В связи с 550-летием прославления, 1422—1972) Славится Русская земля своими святыми угодниками, и среди них особое место занимает Преподобный Сергий, поднявший духовную жизнь Руси на новую высоту. Сохранилось много свидетельств...»



«СЕЛСКОСТОПАНСКА АКАДЕМИЯ AGRICULTURAL ACADEMY ИНСТИТУТ ЗА ИЗСЛЕДВАНЕ И РАЗВИТИЕ НА ХРАНИТЕ FOOD RESEARCH& DEVELOPMENT INSTITUTE Международна научно-практическа конференция International Scientific-Practical Conference Храни, технологии...»


«Последняя Земля Самый эффективный метод спасения Планеты, Животных и Человечества. by Life, 4vegan.ru Интро Люди по всему миру стараются делать такой выбор, чтобы как можно меньше противоречить своим идеалам. Мы упрощаем нашу жизнь, приобретая...»


«РОССЕЛЬХОЗНАДЗОР ИНФОРМАЦИОННО-АНАЛИТИЧЕСКИЙ ЦЕНТР ЭПИЗООТИЧЕСКАЯ СИТУАЦИЯ В СТРАНАХ МИРА №89 30.04.15 Официальная информация: МЭБ Коста-Рика: болезнь Ньюкасла Польша: африканская чума свиней Ко...»

«Министерство сельского хозяйства Российской Федерации федеральное государственное бюджетное образовательное учреждение (ОчГРАРНЫЙ высшего образования УНИВЕРСИТЕТ "Санкт-Петербургский государственный аграрный университет" СИСТЕМА МЕНЕДЖМЕНТА КАЧЕСТВА Основ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение Высшего профессионального образования "НОВОЧЕРКАССКАЯ ГОСУДАРСТВЕННАЯ МЕЛИОРАТИВНАЯ АКАДЕМИЯ" (ФГБОУ ВПО НГМА) Лесохозяйственный факультет Материал...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение высшего образования "Курская государственная сельскохозяйственная академия имени И.И. Иванова"...»

2017 www.net.knigi-x.ru - «Бесплатная электронная библиотека - электронные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.